Luvero Family

Islamic Forum of MIG33 Luvero Family
 
IndeksPortalCalendarFAQPencarianAnggotaGroupPendaftaranLogin
Login
Username:
Password:
Login otomatis: 
:: Lupa password?
Luvero_family
Latest topics
» Soft smart setting v.2.10 s60v3
Fri Nov 04, 2011 1:41 am by andrh1

» Aplikasi s60.V3 corel player 1.30
Sun Sep 25, 2011 10:13 am by nyeropo

» Lock room anda
Tue Sep 06, 2011 3:12 am by bajangstyle

» FORSAL3 EMOTE STORE by kariayam
Wed Aug 17, 2011 2:28 pm by soelist

» Mig33+Opmin in 1 app
Fri Aug 12, 2011 3:47 am by Ikaz_wong

» Mig33 4.5 tema freezerland
Fri May 06, 2011 2:14 pm by madat

» Moderator2 LUVERO ??
Wed Apr 13, 2011 12:45 pm by soul-sick

» VB Spy (SPY RUM MULTI IP)
Wed Apr 13, 2011 12:41 pm by soul-sick

» TUNTUNAN KEHIDUPAN (semoga bermanfaat)
Thu Feb 24, 2011 10:28 am by sky.bd

Top posters
rizqi11
 
sky.bd
 
soul-sick
 
Virgin_eye
 
s-cc
 
Freedie
 
anne ray
 
kha-riem
 
chif
 
p0p
 
Affiliates
free forum

Affiliates
free forum


Share | 
 

 FLU SINGAPURA

Topik sebelumnya Topik selanjutnya Go down 
PengirimMessage
rizqi11
co-admin
co-admin


Zodiac : Aquarius
Jumlah posting : 795
Age : 35
Lokasi : Jakarta Utara

PostSubyek: FLU SINGAPURA   Wed Apr 15, 2009 4:15 pm

Awas!! Flu Singapura sudah sampai di Indonesia!!


"Sebanyak delapan anak balita dalam satu kompleks Perumahan Bella Cassa di RT 1 RT 2 RW 8 Kelurahan Tirtajaya, Sukmajaya, Depok terjangkit flu singapura. Hal itu diketahui dari hasil pantauan Kepala Puskesmas Sukmajaya, Linda Patrias. Balita yang terkena penyakit ini mengalami bintik merah di sekujur tubuh, demam sampai 38-39 derajat celcius, serta sariawan memenuhi mulut yang mirip jamuran. Kepala Dinas Kesehatan Depok Hardiono mengatakan, delapan kasus flu singapura diketahui dari hasil diagnosa dokter spesialis penyakit dalam RS Hermina. "Jadi delapan anak ini berobat ke Hermina dan indikasinya sama terkena flu singapura," paparnya di Depok, Senin (13/4/2009).Menurut Hardiono, penyakit ini disebabkan oleh argo virus yang ditularkan melalui udara dan antarmanusia, serta terjadi dalam satu blok. "Saat ini kondisi kedelapan anak itu sudah baik, tapi bintik-bintik merahnya masih ada," ujarnya. Dia menambahkan, penyakit flu singapura ini sebenarnya tidak telalu berbahaya bagi balita, namun membutuhkan perawatan intensif hingga sepuluh hari. Tindakan dari Dinas Kesehatan Depok untuk mencegah penularan penyakit ini adalah turun ke lapangan dan melakukan tindakan -tinggi kalori tinggi protein- (TKTP). Yakni meninggikan kadar kalori dan protein di wilayah tersebut, sehingga anak memiliki daya tahan tubuh terhadap serangan flu singapura. Dari pantauan, Sifa (4), salah satu anak yang mengidap flu singapura, kondisi kesehatannya mulai pulih, namun bintik merah masih terlihat jelas. Sifa kena bintik merah di telapak kaki yang sebelumnya mengalami demam, tidak mau makan dan muntah-muntah disertai sariawan. "Saya kasih obat sariawan biar bisa makan dan minum karena seperti ada jamur di mulunya. Saat itu panasnya sampai 38 derajat celcius," papar Elhida, ibu korban yang tinggal di Blok D4 Nomor 7 Perumahan Bella Cassa.


***Sumber : SuaraMedia.Com, Senin, 13 April 2009 14:12
(dikutip : ratualit.blogspot.com)

_________________
"MERDEKA atau MATI !!! KIBARKAN sang MERAH PUTIH di PERSADA NUSANTARA"
Kembali Ke Atas Go down
Lihat profil user
sky.bd
Moderator
Moderator


Zodiac : Aries
Jumlah posting : 534
Age : 30
Lokasi : didalam hati orang2 yang tersingkirkan dan berada dalam kesedihan.

PostSubyek: Re: FLU SINGAPURA   Wed Apr 15, 2009 10:22 pm

MARI AKU JELASIN MENGENAI PENYAKIT INI

"Flu Singapura" sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.

GAMBARAN KLINIK :
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :

o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.

Komplikasi penyakit ini adalah :

o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (KTM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10

LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

1. Deteksi Virus :
o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B

Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)

3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

TATALAKSANA :
o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :
Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

o Pengobatan simptomatik :
Antiseptik didaerah mulut Analgesik misal parasetamol Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:

Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.

Hand-Foot-Mouth Disease (HFMD)
Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari

Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.

Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.
Diagnosis Banding : Varisela, herpes
Terapi : Simptomatis
Kembali Ke Atas Go down
Lihat profil user http://doctorsky89.blogspot.com
 
FLU SINGAPURA
Topik sebelumnya Topik selanjutnya Kembali Ke Atas 
Halaman 1 dari 1

Permissions in this forum:Anda tidak dapat menjawab topik
Luvero Family :: LAIN - LAIN :: Medical-
Navigasi: